Page is loading ...
For Research Use Only. Not for use in diagnostic procedures.
Thermo Scientific™ MuSeek Library
Preparation Kit
USER GUIDE
for use with:
Ion PGM™ System
Ion Proton™ System
Catalog Number K1331
Publication Number MAN0015938
Revision A.0
The information in this guide is subject to change without notice.
DISCLAIMER: TO THE EXTENT ALLOWED BY LAW, LIFE TECHNOLOGIES AND/OR ITS AFFILIATE(S) WILL NOT BE LIABLE FOR SPECIAL, INCIDENTAL,
INDIRECT, PUNITIVE, MULTIPLE, OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING YOUR
USE OF IT.
Revision history: Pub. No. MAN0015938
Revision Date Description
A.0 16 January 2017 • This document is a replacement of the Thermo Scientific™ Museek
Library Preparation Kit Product Information Sheet (MAN0012947).
• Revision of storage conditions
• Minor protocol revisions
Important Licensing Information: These products may be covered by one or more Limited Use Label Licenses. By use of these products, you accept
the terms and conditions of all applicable Limited Use Label Licenses.
Corporate entity: Life Technologies Corporation | Carlsbad, CA 92008 USA | Toll Free in USA 1 800 955 6288
TRADEMARKS: All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
©2017 Thermo Fisher Scientific Inc. All rights reserved.
Contents
■CHAPTER 1 Product information ....................................... 4
Description ..................................................................... 4
Technology overview ............................................................. 5
Contents and storage ............................................................ 5
Required materials not supplied .................................................. 6
Workflow ...................................................................... 7
■CHAPTER 2 Procedure ................................................... 8
Input DNA requirements and general recommendations ............................. 8
Fragmentation .................................................................. 9
Purify fragmented DNA ......................................................... 10
Adaptor addition PCR ........................................................... 11
Purify library .................................................................. 12
Size-selection and library quantification .......................................... 13
Size selection ............................................................. 13
Evaluation of prepared sequencing library .................................... 14
Sequencing ................................................................... 15
For sequence analysis with Torrent Browser .................................. 15
■APPENDIX A Troubleshooting ......................................... 16
■APPENDIX B Sequences ............................................... 18
Sequences .................................................................... 18
■Safety ...................................................................... 20
Biological hazard safety ......................................................... 21
Chemical safety ................................................................ 21
■Documentation and support ............................................. 23
Customer and technical support ................................................. 23
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
3
Product information
Description
Thermo Scientic™ MuSeek Library Preparation Kit for Ion Torrent™ is designed for
generation of high‐quality genomic DNA libraries for sequencing with the Ion
Personal Genome Machine™ (PGM™) and Ion Proton™ systems. The fast protocol uses
the MuA transposase enzyme, which catalyzes simultaneous fragmentation of
double‐stranded target DNA and tagging the fragment ends with transposon DNA.
In a subsequent PCR step, the platform-specic adaptors are added using a robust
and accurate Thermo Scientic™ Phusion™ High‐Fidelity DNA polymerase. Starting
with only 100 ng of the sample the same protocol can be used to generate 100–400 bp
insert libraries.
The kit contains components sucient for 10 fragmentation and the subsequent
adaptor‐addition polymerase chain reactions. The kit also contains a MuA-specic
sequencing primer that is required in the PGM™ sequencing runs when non‐barcoded
libraries are prepared by this method.
1
4
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
Technology overview
MuA transposase enzyme is a 75 kDa protein originating from bacteriophage Mu, and
is produced as a recombinant protein in E. coli. Under suitable conditions, MuA
transposase forms a homotetrameric complex with two 50 bp double‐stranded
transposon DNA ends that contain a specic MuA binding sequence. After the
fragmentation reaction, the ends of target DNA are tagged with transposon
sequences. PGM™-specic adaptors are added to the fragments in a subsequent
adaptor‐addition reaction. First, the 3'‐ends of the fragmented target DNA are
elongated over the 5 nt gaps generated during the transposition reaction and further
extended into transposon sequences. In the initial cycles of consecutive PCR the rst
16 nt of the adaptor 3'‐ends hybridize to transposon sequences in tagged DNA
fragments. In later PCR cycles the fragments are amplied using a pair of external
primers
Contents and storage
Contents Cap color Amount (µL) Storage [1]
Museek Enzyme Mix Red 20 µL -20°C
MuSeek Fragmentation Reaction
Buffer
Yellow 100 µL
Control DNA[2] White 10 µL
MuSeek Adaptor Addition Primer
Mix
Purple 40 µL
MuSeek Adaptor Addition Reaction
Buffer
Green 1 mL
Phusion™ Hot Start II High-Fidelity
DNA Polymerase
Blue 40 µL
MuSeek Sequencing Primer [3] White 300 µL
MuSeek Stop Solution Orange 30 µL Room
temperature
[1] The kit is shipped on dry ice.
[2] 50 ng/μL cI857 Sam7 Lambda DNA, size 48.5 kb
[3] This primer must be used ONLY when sequencing non-barcoded MuSeek libraries. For barcoded MuSeek
libraries use original sequencing primer, provided in the Ion Sequencing Kit.
Chapter 1 Product information
Technology overview
1
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
5
Required materials not supplied
Unless otherwise indicated, all materials are available through thermosher.com.
MLS: Fisher Scientic (sherscientic.com) or other major laboratory supplier.
Item Source
MuSeek Barcode Set 1 K1541
Agencourt™ AMPure™ XP Kit Beckman Coulter A63880
DynaMag™-2 magnet (magnetic rack) 12321D
Agilent™ 2100 Bioanalyzer™ instrument Agilent G2939AA
Agilent™ High Sensitivity DNA Kit Agilent 5067-4626
Eppendorf LoBind™ Tubes, 1.5 mL Fisher Scientific
13-698-791
Eppendorf 022431021
PCR tubes, 0.2-mL MLS
Microcentrifuge MLS
Thermal cycler MLS
Vortex mixer MLS
Pipettors 1–1000 μL MLS
Barrier pipette tips MLS
Nuclease-free Water AM9932
Optional:
10 mM Tris, pH 7.5–8.5 MLS
Item Source
E‑Gel™ iBase™ unit and E‑Gel™ Safe Imager™transilluminator
combo kit
G6465
E‑Gel™ SizeSelect™ 2% Agarose G661002
50-bp DNA ladder (1 μg/μL), required for 100-, 150-, 200- and
400-base-read libraries
10416014
100-bp DNA ladder (1 μg/μL), required for 300-base-read
libraries
15628019
Chapter 1 Product information
Required materials not supplied
1
6
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
Workflow
The MuA transposase complex simultaneously fragments input DNA and tags the
fragments. In a subsequent PCR, adaptor sequences are added.
Chapter 1 Product information
Workflow
1
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
7
Procedure
Input DNA requirements and general recommendations
• The kit is used with 100 ng of high‐quality genomic DNA dissolved in nuclease‐
free water, 10 mM Tris, pH 7.5‐8.5, or TE buer (10 mM Tris‐Cl, pH 8.0, 1 mM
EDTA ). The DNA samples must be free of contaminating proteins, RNA, organic
solvents, and salts. For samples with unknown DNA quality, repurication of
DNA is highly recommended. The best DNA quality is achieved after sample
purication using commercial DNA purication kits, like Thermo Scientic
GeneJET Genomic DNA Purication Kit (Cat. No.K0721, #K0722).
• For construction of NGS library from PCR amplicons in fragmentation reaction
do not use PCR products shorter than 300 bp. Due to intrinsic features of the
transposon technology a ~50 bp drop o is expected in sequencing coverage from
each distal end of the amplicon sequence. This can be averted by designing your
amplicons to be ~100 bases larger than the desired sequencing insert.
• Control DNA is provided in the kit for introductory use of the reagents prior to
using own target DNA samples. Use 100 ng (2 μL) of the Control DNA supplied
in the kit, and then follow the instructions described below.
• Use good laboratory practices to minimize cross‐contamination of products.
Where possible, perform library construction in a separate area or room.
• Thaw frozen reagents on ice before use, and keep them on ice until ready to use.
Minimize the time outside of the ‐20°C freezer for the MuSeek Enzyme Mix.
• Mix reagents thoroughly before use by vortexing or icking the tube, especially if
frozen and thawed.
• For optimal results always prepare a fresh 70% solution before starting the
purication procedure (70% ethanol is hygroscopic).
2
8
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
Fragmentation
IMPORTANT! For successful DNA fragmentation, avoid foaming of the reaction
mixture.
1. IMPORTANT! Always keep the MuSeek Enzyme Mix on ice when preparing the
reactions and minimize handling times outside of the ‐20°C freezer.
Pipet all the reagents, except for MuSeek Enzyme Mix, in the given order into a
0.5‐mL thin‐wall tube. Mix the contents thoroughly by vortexing briey (3–
5 seconds), then briey centrifuge to collect the contents.
Component Amount (µL)
Nuclease-free Water Add to 28 µL
MuSeek Fragmentation Reaction Buffer 10.0 µL
gDNA (100 ng) X µL
Total 28.0 µL
IMPORTANT! Before proceeding, start the vortex at maximum speed.
2. Add 2 μL of MuSeek Enzyme Mix to the other reaction components, mix by
briey touching the vortex ve times (for 1 second each time), then centrifuge
briey to collect contents.
3. Place the tube immediately at 30°C for 5 minutes.
Recommendation: incubate the sample in a water bath for faster heat transfer.
4. Stop the reaction after 5 minutes by adding 3 μL of MuSeek Stop Solution and
vortexing briey.
5. After vortexing, keep the tubes at room temperature.
IMPORTANT! Do not put reaction tubes on ice, as the Stop Solution can cause
precipitation.
Chapter 2 Procedure
Fragmentation
2
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
9
Purify fragmented DNA
Equilibrate the Agencourt™ AMPure™ XP beadss at room temperature at least
30 minutes before starting the purication protocol, and mix well before pipeing.
1. Transfer the DNA sample into a 1.5‐mL tube.
2. Add 49.5 μL of room temperature Agencourt™ AMPure™ XP beads to the
reaction (1.5x sample volume), then mix thoroughly by pipeing up and down
for 10 times (avoid foaming).
3. Incubate for 5 minutes at room temperature.
4. Briey centrifuge, then place the tube in a magnetic rack for 2–4 minutes or until
the solution is cleared.
5. Aspirate, then discard the supernatant carefully without disturbing the beads.
Ensure that no supernatant is left.
6. Keep the tube in the rack and add 400 μL of freshly prepared 70% ethanol
directly onto magnetic beads, incubate for 30 seconds, then remove all the
supernatant.
7. Repeat the ethanol wash in step 6.
8. Air‐dry the beads on the magnet, by opening the tube for 2–5 minutes, allowing
all traces of ethanol to evaporate. Be careful not to over dry the beads (this can be
seen as cracking of the beads).
9. Remove the tube from the magnetic rack, then thoroughly suspend the beads in
25 μL of Nuclease‐free Water by pipeing up and down 10 times.
10. Place the tube in the magnetic rack, then let the solution clear for at least
1 minute.
11. Collect the supernatant without disturbing the pellet into a new sterile tube. This
supernatant contains the puried fragmented DNA, do not discard the
supernatant.
IMPORTANT! This supernatant contains the puried fragmented DNA, do not
discard the supernatant.
Save 1 μL for later analysis of size distribution and concentration of puried
fragments using the Agilent 2100 Bioanalyzer instrument.
Chapter 2 Procedure
Purify fragmented DNA
2
10
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
Adaptor addition PCR
1. Prepare the following reaction mixture:
Component Amount (µL)
Nuclease-free Water 72
MuSeek Adaptor Addition Reaction
Buffer
100
MuSeek Adaptor Addition Primer Mix
or
Selected MuSeek Barcode Adapter
Primer Mix 1-16 from Thermo Scientific
MuSeek Barcode Set 1, Ion Torrent
compatible
4
Purified fragmented DNA [1] 20
Phusion Hot Start II High-Fidelity DNA
Polymerase
4
Total 200
[1] From the previous procedure
2. Aliquot the reaction mixture into four separate 200 μL PCR tubes. (For some
thermal cycler instruments it is recommended to amplify DNA in reaction
volumes not higher than 50 μL).
3. Perform temperature cycling of all four reaction mixture aliquots using the
following cycling conditions:
Temperature (°C) Time Cycles
66 3 min 1
98 30 sec
98 10 sec 8
60 50 sec
72 10 sec
72 1 min 1
4 hold
Chapter 2 Procedure
Adaptor addition PCR
2
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
11
Purify library
Combine all four reactions into one 1.5‐mL tube, then purify the DNA by Agencourt™
AMPure™ XP PCR Purication system.
1. Add 360 μL of room temperature Agencourt™ AMPure™ XP magnetic beads to
the reaction (1.8x sample volume), then mix thoroughly by pipeing up and
down 10 times (avoid foaming).
2. Incubate at room temperature for 5 min.
3. Pulse‐spin, then place the tube in a magnetic rack for 2 minutes or until the
solution is clear.
4. Aspirate the supernatant carefully without disturbing the beads, then discard the
supernatant. Make sure that no supernatant is left.
5. Keep the tube in the rack and add 1 mL of freshly prepared 70% ethanol directly
onto magnetic beads (make sure that all beads are covered by ethanol), incubate
for 30 seconds, then remove the supernatant.
6. Repeat ethanol wash (step 6).
7. Air‐dry the beads on the magnet, by opening the tube for 2–5 minutes, allowing
all traces of ethanol to evaporate. Be careful not to over dry the beads (this can be
seen as cracking of the beads).
8. Remove the tube from the magnetic rack, and thoroughly suspend the beads in
20 μL of nuclease‐free water or 10 mM Tris‐HCl, pH 8.0.
9. Place the tube in the magnetic rack, then let the solution clear for at least
1 minute.
10. Collect the supernatant without disturbing the pellet into a new sterile tube. This
supernatant contains the puried fragmented DNA, do not discard the
supernatant.
Save 1 μL for later analysis of size distribution and concentration of fragments after
adaptor‐addition PCR by using the Agilent™ 2100 Bioanalyzer™ instrument (“Size‐
selection and library quantication“ on page 13). Typically from 200 μL of PCR
reaction mixture at least 100 fmol of DNA (in the fragment length interval of 297–363
297‐363 bp) are generated as measured by theAgilent™ 2100 Bioanalyzer™ instrument.
Chapter 2 Procedure
Purify library
2
12
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
Size-selection and library quantification
Size-selecting correct DNA library fragment length: Sequencing ready libraries
prepared using MuSeek Library Preparation Kit for Ion Torrent™ contain DNA
fragments between ~ 150‐1,500 bp in length. Each fragment includes adaptor
sequences on both ends, 93 base pairs in total for non‐barcoded library. When size‐
selecting libraries of a relevant sequencing read length, the length of adaptor
sequences must be taken into account. For size‐selecting the correct DNA library
fragment peak see the following gure and table.
Target DNA library fragment size for size selection procedure
Sequencing
platform Library size Target peak size
Interval of interest for
barcoded library
concentration
measurement (target
peak ± 10%)
Ion PGM™100-base-read ~200 bp 180-220 bp
200-base-read ~330 bp 297-363 bp
300-base-read ~390 bp 351-429 bp
400-base-read ~470 bp 423-517 bp
Ion Proton™150-base-read ~220 bp 198-242 bp
Size selection recommendations: To perform emulsion‐PCR and subsequent
sequencing reaction eciently, size‐selection by the E‐Gel™ Agarose Gel
Electrophoresis System using an E‐Gel™ SizeSelect™2% Agarose Gel is recommended.
Instructions are in the E‑Gel™ Technical Guide (MAN0000375) and E‑Gel™ SizeSelect™
Agarose Gels Quick Reference (MAN0006812), both of which can be found at
www.thermosher.com.
Note: Save 1 μL of the nal sequencing library for fragment size distribution and
concentration analysis by Agilent™ 2100 Bioanalyzer™.
Size selection
Chapter 2 Procedure
Size-selection and library quantification
2
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
13
Recommendations for the size-selection of barcoded DNA libraries:
• Mix all barcoded libraries at equal molar amounts before E‐Gel™ size selection so
that the nal mix volume is larger than 25 μL.
• We recommend calculating molarity of individual barcoded libraries only within
intervals of interest which are distinct for 100‐400 bp library sizes (table above),
such as for 200 base reads, calculate molarity within the region of 297 to 363 bp,
which corresponds to subsequent target E‐Gel™ size selection peak size (± 10%).
1. Collect all the samples saved from the fragmentation reaction, adaptor‐addition
PCR, and size selection for analysis using the Agilent™ 2100 Bioanalyzer™
instrument.
2. Dilute samples
• After the fragmentation reaction by 2‐fold
• After adaptor‐addition PCR by 4‐fold
Note: The samples after size selection by E‐Gel™ should not be diluted.
3. Analyze all the samples together by the Agilent™ 2100 Bioanalyzer™ instrument
using the High Sensitivity DNA Kit.
Typical example of an analyzed library is shown in the following gure
Relative size distribution of E. coli genomic DNA fragment library generated using MuSeek
Library Preparation Kit. Fragment size distribution was analyzed by the Agilent™ 2100
Bioanalyzer™ instrument using the High Sensitivity DNA Kit (Life Technologies). Red – 2-fold
Evaluation of
prepared
sequencing library
Chapter 2 Procedure
Size-selection and library quantification
2
14
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
diluted DNA fragments after fragmentation reaction; Blue – 4-fold diluted DNA fragments after
Adapter Addition PCR; Green – fragments after size-selection by theE‑Gel™ Agarose Gel
Electrophoresis System on E‑Gel™ SizeSelect™ 2% Agarose Gel.
Sequencing
IMPORTANT! Sequencing primers for non‐barcoded and barcoded DNA fragment
libraries are dierent. Before loading a library onto a chip, select the appropriate
sequencing primer:
For sequencing non‐barcoded libraries generated with this kit: Use only the Museek
sequencing primer provided with this kit.
Note: The addition of Control Ion Sphere™ Particles is not required, as they do not
contain the binding site for the MuSeek Sequencing Primer.
For sequencing barcoded libraries generated with this kit: Use only the original
sequencing primer provided in the appropriate sequencing kit.
Library fragments prepared with this kit carry four bases of MuA transposon
sequence immediately downstream of the key sequence. In order to get the best
sequence alignment results from your PGM™ run, these bases need to be trimmed by
the Torrent Server.
Use the example template provided for this kit (MuSeek Library Template) when
planning runs using a MuSeek library.
The template is found on the templates page which is held under the Plan tab. This
template has defaults selected that identify the MuSeek library 3' adapter
(MuSeek/P1B) and 5’ sequence tag (MuSeek_5prime_tag) that will be trimmed away
during data processing.
For manual upload of barcode sequences, refer to the Torrent Suite™ documentation
available on the Thermo Fisher Scientic website (www.thermosher.com).
For sequence
analysis with
Torrent Browser
Chapter 2 Procedure
Sequencing
2
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
15
Troubleshooting
Observation Possible cause Recommended action
The reaction resulted in low
yield
DNA was over-fragmented. Target DNA was already fragmented.
There was less than 100 ng of target DNA
present. Check the DNA concentration and
make sure that there are no other components
present in solution that may cause over-
estimation of DNA concentration.
Too high amount of MuSeek Enzyme Mix was
added due to a pipetting error.
The fragmentation incubation time was too
long.
The Stop Solution was not added exactly after
the 5-minutes incubation, or the reaction was
not mixed properly after adding the Stop
Solution.
DNA was improperly
fragmented.
The target DNA is impure and contains
contaminants, which inhibited the
fragmentation reaction.
Less than 2.0 µL of the MuSeek Enzyme Mix
was added into the fragmentation reaction due
to a pipetting error.
The MuSeek Enzyme Mix has been improperly
stored (above -20°C).
The fragmentation reaction mixture was not
mixed properly after adding the MuSeek
Enzyme Mix.
The Agencourt AMPure XP PCR
Purification system protocol
was not followed properly.
Discard sample.
A
16
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
Observation Possible cause Recommended action
The reaction resulted in low
yield
The adaptor-addition reaction
was not successful.
The adaptor-addition reaction volume in PCR
tubes was higher than 50 µL, which is too high
for some thermal cycler instruments.
The four adaptor-addition reactions were not
combined before AMPure XP PCR Purification
protocol.
Temperature cycling protocol was not
performed according to the manual. Make sure
that the initial 3-minute incubation at 66°C is
included in the protocol and that the
denaturation and annealing temperatures are
correct.
Not all the required components were added to
the reaction due to pipetting errors.
The size-selection protocol was
not followed properly.
Discard sample.
Appendix A Troubleshooting
Sequencing
A
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
17
Sequences
Sequences
Sequences of the primers and transposon ends:
Primer/Transposon Sequence
MuSeek/A 5’-
CCATCTCATCCCTGCGTGTCTTCGTGCGTCAG
TTCA-3’
MuSeek/A (1-16) barcoded primer [1] 5’-
CCATCTCATCCCTGCGTGTCTCCGACTCAG-
[barcode 1-16]
-TTCGTGCGTCAGTTCA-3’
MuSeek/P1 5’-
CCACTACGCCTCCGCTTTCCTCTCTATGGGCA
GTCGGTGATTTCGTGCGTCAGTTCA-3’
A’ 5’-CCATCTCATCCCTGCGTGTC-3’
P1’ 5’-CCACTACGCCTCCGCTTTCCTCTCTATG-3’
MuSeek Sequencing Primer 5’-CATCTCATCCCTGCGTGTCTTCGTGCG-3’
Transposon end 5’-
GTTTTCGCATTTATCGTGAAACGCTTTCGCGTT
TTTCGTGCGTCAGTTCA-3’
3’-
CAAAAGCGTAAATAGCACTTTGCGAAAGCGCA
AAAAGCACGCAGTCAAGTCGT-5’
[1] The sequences of MuSeek barcoded adaptors are available at Thermo Fisher Scientific website
Sequence structures of adaptor containing target DNA fragment (non-barcoded and
barcoded).
TCAG patch is a key sequence (four different bases) that is used for Ion Torrent instrument
calibration. The sequencing read starts after the key sequence, and if the fragment end is
reached the read will enter the TGAA… sequence of the transposon. The sequences
corresponding to primer A´ and complementary to primer P´ are shown in italics.
Sequence structure
Non-barcoded sequence structure:
5’-CCATCTCATCCCTGCGTGTCTTCGTGCGTCAGTTCA-
[ Target DNA ]
-
TGAACTGACGCACGAAATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGG-3’
B
18
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
Sequence structure
Barcoded sequence structure:
5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-
[ Barcode 1-16 ]
-TTCGTGCGTCAGTTCA-
[ Target DNA ]
-
TGAACTGACGCACGAAATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGG-3’
Appendix B Sequences
Sequences
B
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
19
Safety
WARNING! GENERAL SAFETY. Using this product in a manner not specied
in the user documentation may result in personal injury or damage to the
instrument or device. Ensure that anyone using this product has received
instructions in general safety practices for laboratories and the safety
information provided in this document.
·Before using an instrument or device, read and understand the safety
information provided in the user documentation provided by the
manufacturer of the instrument or device.
·Before handling chemicals, read and understand all applicable Safety Data
Sheets (SDSs) and use appropriate personal protective equipment (gloves,
gowns, eye protection, etc). To obtain SDSs, see the “Documentation and
Support” section in this document.
20
Thermo Scientific
™
Museek Library Preparation Kit for User Guide
/
